pSPCi?2TBK - Fasta Format

Name pSPCi?2TBK
Download
Fasta Detailed sequence
Fasta Format > pSPCi?2TBK
gaactcgagcagctgaagcttgcatgcCTGCAGGTCGACTCTAGAGGATCCGATCAAGCA CTGAGGGTGCTTATTGTTACGAAATTAAACAGAGTTTAAATTTTACAATTGTATGTAGAA CTTTTGAAAGTATAACATGCTGTATTTTAAATGTTATTTTTATACTTTAATTTGCAAAAC TAGCGAACTCCGCATTATGCAAATCATTTCAAAACTTTTGTTAAAACCGGTAAAACAACT GATAATTTTGTAATAACTCAGACTTACAGTGCTGCTATTGGCTGTTTGTGAAAGTTCAGT TTGTTTACAATTTTTGTAATAATTTGATATCTGTTGCCTTACCATTCATAAAAATGAATT TAATACCTTGGCTCACTGTTTTTGTAGTACTAGTGTTTTTATGTTGTTTAATAAACTGAT AATGAATTTAAAGTTGGAAGTTACTGTTCTTGTGAAGGAATTGTCCATAGCTTAGTGGTT AGGCACTCGCATTGGACCAAAGGTTGCTAGTTTGAGACTCGACACTGATACCGAATATGT GTGCAAAACAACATTAATCCAACTACTAGATCACTAATAGGTTGTCCAAATTTTCAGCCA TACAAAACAAAATAAATTAAAAATTATCACATGTTATTACTTCACCAGCAAAGTCAAAAA TGTGGTTACTTGTTAGCCGAAACAAGGTGTCTGAAACAAGAAGCCTGTACAGACTTCGTT GCGTGGATGCAATAAATCTTATTCGTTGATAGGTGTGCCACAAAGCTGTTATGGCGTATT TCGATTTTTATCCGTTAGGTTGCGTTGCAGAGCTGGCGAAGCCAAAACGACTGTTTTTAA AATTAACTGCTAGTCTGCTTACGGTTGGACGGTAAGAATGTTATTGATAAACTAAGAATA GAATCTTTAACGATCAAAATTTTAAGCACCTTAAAGCTTTAAAAGAAGCTCTTAAAAGCA AAATAAAGTGCTAAATAATTAACTGTTTGATTTAGGGTTTAATTTTAAATTTAAAAGAAA CAGAACTATTTTGATAGTAATAAAACTTTTAATATTTTCGCAGTTTTGATTGAAAATTGT TCATGCGACGACTGTTCTGCACACGCTCAGGACCAAAATGTCGAATCACGTCTGTGTGAC GTAACACTGAGACACAGACACCAAGACTCGGTCTTGGGCGCGGTTTTCTATCGATCGACC TGTACTTTGTAATGGGAAGTACCGGCAAAACCGGGATGCATTCTCAAATCGATTGACCAT GAATAATTTATGCTAGGCCAAATGCAGCGAGCGCGTGACTCAGGTATGGATGAGAATTAT GCATTAGGGAATATAAGACGACGCCGTAAAGTTGTACAAGTACCAAGCGACTGTATACAA ACAGCTACATGTGTCTAACACCAAAATTATGACATCATCACATTTATTAGGCAAGTGATT TTTTAATACTATAAAAGGGTTGGATACGATGGAATATGTTTTTATTTTTCTTTCTTGTCC CATCTGGTAGCAAACAAAGAACATTCAAAGAATTATAGAACCGTATCCTCACGACTTCCA GCATAGAACGTTGTTATTTGTTTAAAACACGATCAGGATATTTGGATATTATATGCTAAA GGTGTCGCGGCCTCCCCCACTCTACTGTAACAATTATAGGCCGCGACTTTAAAGGAGAAT TGTTAACTGTGCAAAAAAGGTTCAGGAAATATGGGATTTAAGTGCAAACAGTGTTATCTC ACCCCACACTACTATATTAACTGTGCATTATTCCAATAGCAACGTACTTCCAATACCATA CTACTTTTTCTAGTTTTATTAAAGCGTGATTGCGTTTTATTGTACTTACTATTGCCAGCA GTTCAGTTTTCCCGTCACTTTTTATCGGTTTTACAAATCACTGACTGACTGCACCAATAG CGTTTAAATCTCAATAATTTTGGACAATGGTTTTAATTAGCGATGCAGCTATGTAGTTCA TGGTAGAAAACGAACATCAGTAACCGTAAATGAGAGTTTTCCAACTAATTAATCCGTTAA TCTAGAATTAAATTTAATTGCGTAATTCCATTGTTAAAAAGAACTATAGCAGCTGTTGTG CGATTAAGACAATACATTGTCGTTCGGTTGGTAGTCTCACCCACGAAGACAAAATTCGAA GGAATGAAGGTACTTCTTTTCATCACCAAGCAACGGAATGTTATTCCTGACTTGATCGGG CACGTCGCTAGCGTCGCGTCTTGTACAAATATCAATTTCCAAGCCGAGATTGGAATTCGA TAACAAAGCGCTTCTATCGCTTTCACGGAATTGTATTAAGTTACCATAAGTTCTGACATT TTGGTTCAGGCTTTATAGTAAAAATGATTACCTTTTCACGCAGTGTATGCTGCAACAAAG GTCAGGAAACAGCAGATGCGTTTTATCTTCCTCAATCCACTTTATTTTCACATTTGTTTA AGGTTTCATGTGTACGTTGTATTTGTTCAGATAAACAACAGCAAAAATGAAAGCATCCAT ACACTAAGTCAAGTAATACGTATAATCAAACTATCGAAGTTTTACGGTTTTGACGTACAA AATTGACCTTAAATCAAAACAAAGCGCGGGGTTGGAGTTTTATATTGTGTTGTATAAGGA AAATAACAGCCGAATTCTCGGTGTTTAGATTAACCTACATTATTTGTGATGATACAAAGG AAGAGTTCTCGTTGAAGCTCAAACCCCACCGTTTCAGCCTCTAAATTATTGATAAGTTCG CGCTACGTGATTGGATGCCGTCCAATATATCGAACCCTCAAATAAATTACTCACAGTCTC CCTTATGACGTCATACAGACACCCTGCACCTGTCCTCCCAACGGGAATTCATTATTCTGT GATGCTGTCTTGCCGCAACGAACACCAACTGTTGCATAACAATGCACTGGATTCTAAAAT AGGGCTATTCTTTTTTAACAGCGTGCAGTTTATACACTAACATATGGCCCGCTCACTGCA AGAAAACAAATAAATTTGTCTAGCCTTGGTTAAATTAAGAACATTTGGAGTTTTTACCGT ATGGAAATCGACAAACTGCATTATTATTAATGGCACTTTCGTAACAATTTAATAGCACGC TAAAATTATTGATTGTTAAGTTATAAAAACATCAATACCGGCACACTCGGCGTATCCACG CAGGAGTTCATTTGTCGATAAATTGAAATCAAGCACACTTGATAGGCTAGAATGGTGAAG ATTAAAATGCTAGTTACTCCCAAGTGTACTGTTTCGTCTGGGATTGTTGTAGCTTTTTAT ACTTAGTGGGCTCACTAAAGAGATTGTTTGTATTTAGAAGGACAATTAATGAACATTGAA ACCTCTCAAGAAAATGTGCTTGTTAATCAATTGTACAATTTGAATATGGCCACAAGCTAG CCTTAGATAGTAAAGTTCCCACATATAAGTATTTAAGTTTAAGAACAAATCTATAAAAAA CACACCAACAATCAATATACTGCAACACAGTAACTTGAGCGTGGGCATGGGGGGTTCATA ATAGCTACACAAAGTTAAATAACTCACGAAAATTAAAAAGCCAAAAGCATAACACAAATA CAGTCAAATAAATCAAAGTCCAACATAAGCTAACGTTAAACGTAATGAATAATCCAATTT GTCATTATTTGCATTGCGGTACACAGGATTTCATTGCAACACACGGGGATGACGACCGAC TATGATATTCAGTGTTATGTGTTACTGTACGGATTCGAAATAAATATTTTTTGGTGTCTT TTTCGTTGACACATTTGTTTGCGATCTTACGCCCTACAGATATTTAGGTTACACTGATTA CGGCATGCTTCGGGAATTACAACATAACATTGTCTAATCGTGCGGAAAACTCGCGCGCAC GGGCAACAGACTCGCGCTTTGACGCGATCAGGAATCAAATAATAGCGTTGTTTGAAATGT AAGGCGTCCCTATAGTAACTATTGTGGGACATATACTGGTCACCTTACCTGGTGTATTCT ACAATTGAAGGGTTTGACGGCGAGTTGAGGCTCGCTTGCTATAATGAGTCAACAGACACC ATTGTCTTGTTGCTAGGCAGCCGCGGCTGTTGATTTTCGAAGCCCGTGGAAACGTACCAC TCCGCCGAGAGAAACGAGACCCTCTCGTTCTTTGTTTAATTGATTATTCGCCGCGTTCGC GCGACAAAAAAGTTTCCTACATTATGACGTCATGAATATCGAGCGCCGAGGCGCGCTTAA ATATCGCGACGTGTGGTGCTGTCGTCATTCTGCGATTGAGTCGAGTACAGAGAATATTTT TATATATTTTTAACAATCTTTAGTTTCTATTCATCATGGATCCCCTTGCGGCCGCt ATG GTGAGTCTGATTAAACCAGAAATGAAGATCAAGCTGCTTATGGAAGGCAATGTAAACGGG CACCAGTTTGTTATTGAGGGAGATGGAAAAGGCCATCCTTTTGAGGGAAAACAGAGTATG GACCTTGTAGTCAAAGAAGGCGCACCTCTCCCTTTTGCCTACGATATCTTGACAACAGCA TTCCATTATGGTAACAGGGTTTTTGCTAAATACCCAGACCATATACCAGACTACTTCAAG CAGTCGTTTCCCAAAGGGTTTTCTTGGGAGCGAAGCCTGATGTTCGAGGACGGGGGCGTT TGCATCGCTACAAATGACATAACACTGAAAGGAGACACTTTTTTTAACAAAGTTCGATTT GATGGCGTAAACTTTCCCCCAAATGGTCCTGTTATGCAGAAGAAGACTCTGAAATGGGAG GCATCCACTGAGAAAATGTATTTGCGTGATGGAGTGTTGACGGGCGATATTACAATGGCT CTGCTGCTTAAAGGAGATGTCCATTACCGATGTGACTTCAGAACTACTTACAAATCTAGG CAGGAGGGTGTCAAGTTGCCAGGATATCACTTTGTCGATCACTGCATCAGCATATTGAGG CATGACAAAGACTACAACGAGGTTAAGCTGTATGAGCACGCTGTTGCCCATTCTGGATTG CCGGACAACGTCAAGTAAgaattcCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTC TGGTGTCAAAAATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAA TCCATTATGTACTATTTAAAAAACACAAACTTTTGGATGTTCGGTTTATTCTTTTTCTTT TACTTTTTTATCATGGGAGCCTACTTCCCGTTTTTCCCGATTTGGCTACATGACATCAAC CATATCAGCAAAAGTGATACGGGTATTATTTTTGCCGCTATTTCTCTGTTCTCGCTATTA TTCCAACCGCTGTTTGGTCTGCTTTCTGACAAACTCGGAACTTGTTTATTGCAGCTTATA ATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGC ATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGACAAAG TCAAAGCGGCCATCAGATCTGCcggtctccctatagtgagtcgtattaatttcgataagc caggttaacctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggg cgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcg gtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcagga aagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctg gcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcag aggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctc gtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg ggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgtt cgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatcc ggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcc actggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtgg tggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagcca gttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagc ggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagat cctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatt ttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagt tttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatc agtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactcccc gtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgata ccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagg gccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgc cgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgct acaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaa cgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggt cctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagca ctgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtac tcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtca atacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgt tcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaaccc actcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagca aaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaata ctcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagc ggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccc cgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaat aggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctga cacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaa gcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggca tcagagcagattgtactgagagtgcaccatatggacatattgtcgttagaacgcggctac aattaatacataaccttatgtatcatacacatacgatttaggtgacactata