Name Type Vector Created Method Expression at the larval stage Expression at the juvenile stage Expression at the adult stage Phenotypes Sequence of insertion site Gene present at the insertion site E[MiCiTPOG]2 Enhancer detection pMiCiTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle (zone 2, 4, 8), peripharyngeal band, retropharyngeal band, languet TAGAGGTACAAAGATTCTGGTGTTTAAAAAGGTTAAGAACCACTGCTGTATTTTACA Ci-musashi E[MiTSAdTPOG]1 Enhancer detection pMiTSAdTPOG DNA/RNA microinjection no expression a part of intestine, ampulla taTAAGGATATAAGGTATATGTTTGATACTTGCAACAACCATCGTCGTAGTTAT Ci-CamL E[MiTSAdTPOG]2 Enhancer detection pMiTSAdTPOG DNA/RNA microinjection no expression no expression tentacles E[MiTSAdTPOG]6 Enhancer detection pMiTSAdTPOG DNA/RNA microinjection no expression stigmatal cells, intestine stigmatal cells E[MiTSAdTPOG]7 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression languet languet E[MiTSAdTPOG]10 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression ampulla, oral siphon edge cupular organ TATTAAAAATGACGCAAAAGCGACTTCACAACAAAGTCACACATATAGTT KH.C1.950, Ci-HSPA12 E[MiTSAdTPOG]15 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression ganglion ganglion TAGCTGCAAGGTTTAACCCACGCCTTTTAATAGAGCTTCTTTGTTGAAACA Ci-GALNT6-related, Ci-SMPD3 E[MiTSAdTPOG]16 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression ganglion ganglion E[MiTSAdTPOG]17 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression endostyle endostyle E[MiTSAdTPOG]18 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression epidermis in stalk endostyle TACTCTTTATTTTGCAGGCATTACTGCGAACGAATGTACTCTTATT KH.C6.19 E[MiTSAdTPOG]19 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression oesophagus, gill E[MiTSAdTPOG]22 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression peribranchial epithelium branchial sac E[MiTSAdTPOG]24 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression stigmata, heart, endostyle, epidermis, stomach, oesophagus, retropharyngeal band EJ[MiTSAdTPOG]10 Enhancer detection pISMiTSAdTPOG jump starter no expression oral siphon edge oviduct, heart EJ[MiTSAdTPOG]17 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, peripharyngeal band EJ[MiTSAdTPOG]21-1 Enhancer detection pISMiTSAdTPOG jump starter no expression stigmata EJ[MiTSAdTPOG]21-2 Enhancer detection pISMiTSAdTPOG jump starter no expression ubiquitous ubiquitous EJ[MiTSAdTPOG]24 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle ovary EJ[MiTSAdTPOG]35 Enhancer detection pISMiTSAdTPOG jump starter no expression stigmatal cells stigmatal cells EJ[MiTSAdTPOG]36-2 Enhancer detection pISMiTSAdTPOG jump starter no expression oesophagus TAAATCTTCATAAAGTTAGTTTAGCTGGGTCGGCTAATAAATCTATTCACG Ci-Fz5/8, KH.C9.783 EJ[MiTSAdTPOG]36-3 Enhancer detection pISMiTSAdTPOG jump starter no expression heart, intestine EJ[MiTSAdTPOG]38 Enhancer detection pISMiTSAdTPOG jump starter no expression stigmata, intestine, endostyle stigmata, intestine, endostyle, languet EJ[MiTSAdTPOG]41 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle EJ[MiTSAdTPOG]42 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle EJ[MiTSAdTPOG]47-1 Enhancer detection pISMiTSAdTPOG jump starter no expression oral siphon, ganglion, endostyle, peripharyngeal band, retropharyngeal band EJ[MiTSAdTPOG]47-2 Enhancer detection pISMiTSAdTPOG jump starter no expression intestine EJ[MiTSAdTPOG]71 Enhancer detection pMiTSAdTPOG jump starter no expression posterior part of the stomach TatACTACCTGtTATTGCAAGACCAAAGCCAAAAATAATCtTTTTAtGCAACATCATTATCG KH.L20.24 EJ[MiTSAdTPOG]75 Enhancer detection pMiTSAdTPOG jump starter no expression stomach TAGAATATAAACATTACCTGTAGTAGCATGAACAACTTGATTTACTGACACA Ci-VWFL3 EJ[MiTSAdTPOG]87 Enhancer detection pMiTSAdTPOG jump starter no expression intestine TAtATGGCATGTTGCAGCTGTTTAAATATACCATTTCACACCTTAGTATATA Ci-ADCY5/6 EJ[MiTSAdTPOG]92 Enhancer detection pMiTSAdTPOG jump starter no expression pyloric gland TATTATGTATGGGTGAGGTACAGTGAGGCACGCCATGGGACCTGGGGTTTA Ci-SoxD EJ[MiTSAdTPOG]101 Enhancer detection pMiTSAdTPOG jump starter no expression stomach TaGTAGTTTGtAGTTAAGTATTTACTCTGTTACTTCACTATGAGGACCAACG Ci-ELOVL3/6a EJ[MiTSAdTPOG]107 Enhancer detection pMiTSAdTPOG jump starter no expression gut TAGAACTTATTCAGTGGTAATTGTATCTCTTGTTGATAGTAGCCCTTTTAAA Ci-FoxA-b EJ[MiTSAdTPOG]123 Enhancer detection pMiTSAdTPOG jump starter no expression pyloric gland TACCCCTTGATAAACAAGAACGGAGGCAACTGGTCGGTTCGGGATATTACC Ci-SMG5, Ci-groucho2 EJ[MiTSAdTPOG]65 Enhancer detection pMiTSAdTPOG jump starter no expression gill EJ[MiTSAdTPOG]103 Enhancer detection pMiTSAdTPOG jump starter no expression gill EJ[MiTSAdTPOG]62 Enhancer detection pMiTSAdTPOG jump starter no expression edge of the oral and atrial siphon cupular organ TACCTGTAAAGTTCATTAAATTTTTGAAGCCACTTTAAAATTATGACAAC KH.C1.950/Ci-HSPA12 EJ[MiTSAdTPOG]104 Enhancer detection pMiTSAdTPOG jump starter no expression endostyle, CNS EJ[MiTSAdTPOG]111 Enhancer detection jump starter no expression endostyle EJ[MiTSAdTPOG]115 Enhancer detection pMiTSAdTPOG jump starter no expression CNS EJ[MiTSAdTPOG]117 Enhancer detection pMiTSAdTPOG jump starter no expression endostyle, peripharyngeal band, retropharyngeal band EJ[MiTSAdTPOG]58-1 Enhancer detection pISMiTSAdTPOG jump starter no expression neural tissue EJ[MiTSAdTPOG]60 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, peripharyngeal band, retropharyngeal band, gill, neural tissue, epidermis EJ[MiTSAdTPOG]68 Enhancer detection pMiTSAdTPOG jump starter no expression endostyle, cerebral ganglion EJ[MiTSAdTPOG]76 Enhancer detection pISMiTSAdTPOG jump starter papillae, CNS, endoderm endostyle, peripharyngeal band, retropharyngeal band, oesophagus EJ[MiTSAdTPOG]78 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, retropharyngeal band EJ[MiTSAdTPOG]70 Enhancer detection pMiTSAdTPOG jump starter no expression gill, stigmatal cell, endostyle EJ[MiTSAdTPOG]73 Enhancer detection pMiTSAdTPOG jump starter no expression gill, stigmatal cell, CNS, ganglion EJ[MiTSAdTPOG]88 Enhancer detection pMiTSAdTPOG jump starter no expression tunic cell EJ[MiTSAdTPOG]88-7 Enhancer detection pMiTSAdTPOG jump starter no expression blood cell, endostyle EJ[MiTSAdTPOG]88-8 Enhancer detection pMiTSAdTPOG jump starter no expression CNS, dorsal strand, ganglion EJ[MiTSAdTPOG]106 Enhancer detection pMiTSAdTPOG jump starter no expression CNS, ganglion, body wall muscle EJ[MiTSAdTPOG]125 Enhancer detection pMiTSAdTPOG jump starter no expression dorsal strand TAGGTCGGATTATGTCATTACCCCGTCGGCTACGATAGCGCACGCAGTGACGAAGGTAGATAATAAGAGCGACGTACGTTTTAAAACCACCTACGCGTCG KH.C8.840 E[MiTSAdTPOG]25 Enhancer detection pISMiTSAdTPOG jump starter no expression gill, oral siphon, E[MiTSAdTPOG]26 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, blood cell, E[MiTSAdTPOG]27 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, gill, stigmatal cell EJ[MiTSAdTPOG]91 Enhancer detection pMiTSAdTPOG jump starter no expression gill, intestine, epidermis, endostyle EJ[MiTSAdTPOG]77 Enhancer detection pISMiTSAdTPOG jump starter no expression blood, endostyle, retropharyngeal band, stomach, esophagus