MMP-2/9/13 (KH.L76.4)
Vector name |
pEF1>MMP-2/9/13TALEN-L pEF1>MMP-2/9/13TALEN-R pZip>MMP-2/9/13TALEN-L pZip>MMP-2/9/13TALEN-R |
Target sequence (lower case: spacer) | ACACACCAGACATGAGTccatgccgtgttcgtaACACATTCAAGAGAGC (upper case indicates the TALEN binding sites, and lower case indicates spacer) |
Position of target site | 4th exon |
Primers for mutation detection (5’to 3’) | aagcgaacagaatacagcacac atgacgacacaaaacggatctc |
CelI analysis | MMP2-EF-CelI.pdf |
Sequenced mutations | MMP-EF1-mutation.pdf |
Reference | Kawai et al (2015) Developmental Biology 403, 43-56 |