Strain Detail

If you wish to request for strains, please contact Yasunori Sasakura () to check if stock is available.

* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.

Name E[MiTSAdTPOG]15
Type Enhancer detection
Vector pISMiTSAdTPOG
transgene (derived organism)  • Minos (Drosophila hydei)
 • pBluescript (plasmid vector)
 • GFP (Aequorea victoria)
 • SV40 polyadenylation sequence (Papovavirus SV40)
 • nuclear localization sequence (Papovavirus SV40)
 • Splicing acceptor sequence (Oryctolagus cuniculus)
 • I-SceI restriction site
Created Method remobilization by microinjection
Expression at the larval stage no expression
Expression at the juvenile stage ganglion
Expression at the adult stage ganglion
Picture at the larval stage
Picture at the juvenile stage
Picture at the adult stage
Phenotypes
Sequence of insertion site TAGCTGCAAGGTTTAACCCACGCCTTTTAATAGAGCTTCTTTGTTGAAACA
Gene present at the insertion site Ci-GALNT6-related, Ci-SMPD3
Reference Awazu S et al., High-throughput enhancer trap by remobilization of transposon Minos in Ciona intestinalis., Genesis. 2007 May;45(5):307-17.

Dahlberg C et al., Refining the Ciona intestinalis model of central nervous system regeneration., PLoS ONE. 2009;4(2):e4458. Epub 2009 Feb 12.

Auger H et al (2010) Dev. Biol. 339(2),374-89

Hozumi A et al (2013) Dev. Biol. 375(1),79-91

Sasakura Y et al (2018) Wiley Interdiscip Rev Dev Biol 7(2),

Sasakura Y et al (2018) Adv. Exp. Med. Biol. 1029(),121-129

Available sperm
juvenile
adult
 animal(s)