Name Type Vector Created Method Expression at the larval stage Expression at the juvenile stage Expression at the adult stage Phenotypes Sequence of insertion site Gene present at the insertion site Tg[MiCiTnIG]2 Marker pMiCiTnIG DNA/RNA electroporation muscle muscle, heart muscle, heart Tg[MiCiEpiIG]3 Marker pMiCiEpiIG DNA/RNA electroporation epidermis epidermis Tg[MiCiEpiIG]4 Marker pMiCiEpiIG DNA/RNA electroporation epidermis epidermis Tg[MiCiCesAG]1 Marker pMiCiCesAG DNA/RNA electroporation epidermis epidermis epidermis Tg[MiCiBraG]1 Marker pMiCiBraG DNA/RNA electroporation notochord no expression Tg[MiCiBraG]2 Marker pMiCiBraG DNA/RNA electroporation notochord no expression Tg[MiCiNutG]3 Marker pMiCiNutG DNA/RNA electroporation neural tissue neural tissue neural tissue Tg[MiCiNutG]4 Marker pMiCiNutG DNA/RNA electroporation neural tissue neural tissue neural tissue Tg[MiCiTnIGCiprmG]2 Marker pMiCiTniGCiprmG DNA/RNA electroporation muscle muscle, heart muscle, heart, testis, sperm Tg[MiCiTnIGCiprmG]3 Marker pMiCiTniGCiprmG DNA/RNA electroporation muscle muscle, heart muscle, heart, testis, sperm Tg[MiCiTrlG]1 Marker pMiCiTrlG DNA/RNA electroporation no expression ubiquitous ubiquitous Tg[MiCiEF1aG]1 Marker pMiCiEF1aG DNA/RNA electroporation ubiquitous ubiquitous ubiquitous Tg[MiCiVHG]1 Marker pMiCiVHG DNA/RNA electroporation no expression stomach no expression Tg[MiCiAKRK]1 Marker pMiCiAKRK DNA electroporation into Ju[SBFr3dTPORCiNutMiTP]1 egg mesenchyme blood cells, tunic cells, stomach, intestine TATTGTCTGTTTGATCAGCTGCGTTCAATCAGTCGCCTGAAATTCGACCA,
TACATTTAAGCCTTGCCTGTAAACGCTAAATTTAGTTAAGCCCACGTTTA KH.C9.476 E[MiCiTPOG]2 Enhancer detection pMiCiTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle (zone 2, 4, 8), peripharyngeal band, retropharyngeal band, languet TAGAGGTACAAAGATTCTGGTGTTTAAAAAGGTTAAGAACCACTGCTGTATTTTACA Ci-musashi E[MiTSAdTPOG]1 Enhancer detection pMiTSAdTPOG DNA/RNA microinjection no expression a part of intestine, ampulla taTAAGGATATAAGGTATATGTTTGATACTTGCAACAACCATCGTCGTAGTTAT Ci-CamL E[MiTSAdTPOG]2 Enhancer detection pMiTSAdTPOG DNA/RNA microinjection no expression no expression tentacles E[MiTSAdTPOG]6 Enhancer detection pMiTSAdTPOG DNA/RNA microinjection no expression stigmatal cells, intestine stigmatal cells E[MiTSAdTPOG]7 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression languet languet E[MiTSAdTPOG]10 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression ampulla, oral siphon edge cupular organ TATTAAAAATGACGCAAAAGCGACTTCACAACAAAGTCACACATATAGTT KH.C1.950, Ci-HSPA12 E[MiTSAdTPOG]15 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression ganglion ganglion TAGCTGCAAGGTTTAACCCACGCCTTTTAATAGAGCTTCTTTGTTGAAACA Ci-GALNT6-related, Ci-SMPD3 E[MiTSAdTPOG]16 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression ganglion ganglion E[MiTSAdTPOG]17 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression endostyle endostyle E[MiTSAdTPOG]18 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression epidermis in stalk endostyle TACTCTTTATTTTGCAGGCATTACTGCGAACGAATGTACTCTTATT KH.C6.19 E[MiTSAdTPOG]19 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression oesophagus, gill E[MiTSAdTPOG]22 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression peribranchial epithelium branchial sac E[MiTSAdTPOG]24 Enhancer detection pISMiTSAdTPOG remobilization by microinjection no expression stigmata, heart, endostyle, epidermis, stomach, oesophagus, retropharyngeal band EJ[MiTSAdTPOG]10 Enhancer detection pISMiTSAdTPOG jump starter no expression oral siphon edge oviduct, heart EJ[MiTSAdTPOG]17 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, peripharyngeal band EJ[MiTSAdTPOG]21-1 Enhancer detection pISMiTSAdTPOG jump starter no expression stigmata EJ[MiTSAdTPOG]21-2 Enhancer detection pISMiTSAdTPOG jump starter no expression ubiquitous ubiquitous EJ[MiTSAdTPOG]24 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle ovary EJ[MiTSAdTPOG]35 Enhancer detection pISMiTSAdTPOG jump starter no expression stigmatal cells stigmatal cells EJ[MiTSAdTPOG]36-2 Enhancer detection pISMiTSAdTPOG jump starter no expression oesophagus TAAATCTTCATAAAGTTAGTTTAGCTGGGTCGGCTAATAAATCTATTCACG Ci-Fz5/8, KH.C9.783 EJ[MiTSAdTPOG]36-3 Enhancer detection pISMiTSAdTPOG jump starter no expression heart, intestine EJ[MiTSAdTPOG]38 Enhancer detection pISMiTSAdTPOG jump starter no expression stigmata, intestine, endostyle stigmata, intestine, endostyle, languet EJ[MiTSAdTPOG]41 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle EJ[MiTSAdTPOG]42 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle EJ[MiTSAdTPOG]47-1 Enhancer detection pISMiTSAdTPOG jump starter no expression oral siphon, ganglion, endostyle, peripharyngeal band, retropharyngeal band EJ[MiTSAdTPOG]47-2 Enhancer detection pISMiTSAdTPOG jump starter no expression intestine Mu[ISMiTSAdTPOG]1 Jump starter/Mutator pISMiTSAdTPOG meganuclease no expression a part of endostyle no expression Mu[MiTSAdTPOG]8 Jump starter/Mutator pMiTSAdTPOG DNA/RNA microinjection no expression a part of endostyle no expression Ju[SBFr3dTPORCiprmMiTP]1 Jump starter/Mutator pSBFr3dTPORCiprmMiTP DNA electroporation no expression muscle, endostyle, peripharyngeal band, retropharyngeal band (RFP) muscle, endostyle, peripharyngeal band, retropharyngeal band (RFP) sperm (MiTP) Ju[SBFr3dTPORCiprmMiTP]2 Jump starter/Mutator pSBFr3dTPORCiprmMiTP DNA electroporation no expression muscle, endostyle, peripharyngeal band, retropharyngeal band (RFP) muscle, endostyle, peripharyngeal band, retropharyngeal band (RFP) sperm (MiTP) Ju[SBFr3dTPORCiNutMiTP]1 Jump starter/Mutator pSBFr3dTPORCiNutMiTP DNA electroporation no expression muscle, endostyle, peripharyngeal band, retropharyngeal band (RFP) muscle, endostyle, peripharyngeal band, retropharyngeal band (RFP) egg (MiTP) Tg[MiCiCesACsCesA-CiEpiIG]4 Other pMiCiCesACsCesA-CiEpiIG DNA/RNA electroporation epidermis (GFP, CsCesA) epidermis (GFP, CsCesA) Tg[MiTFr3dTPOG]117 Other pMiTFr3dTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle, peripharyngeal band, retropharyngeal band swimming juvenile (Tg[MiTFr3dTPOG]45) Mutant pMiTFr3dTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle, peripharyngeal band, retropharyngeal band defect in metamorphosis and tunic formation Ci-CesA swimming juvenile2 (Tg[MiTFr3dTPOG]153) Mutant pMiTFr3dTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle, peripharyngeal band, retropharyngeal band tail regression failed Mutant natural defect in metamorphosis Tg[MiCiVACHTK]5 Marker pMiCiVACHTK DNA/RNA electroporation acetylcholine neuron acetylcholine neuron acetylcholine neuron Tg[MiCiβ2TBK]2 Marker pMiCiβ2TBK DNA/RNA electroporation pan neuron pan neuron,muscle, endostyle, peripharyngeal band, stigmata, intestine pan neuron,muscle, endostyle, peripharyngeal band, stigmata, intestine Tg[MiCiTHK]2 Marker pMiTHK DNA/RNA electroporation dopamine neuron Tg[MiCiVGATK]1 Marker pMiCiVGATK DNA/RNA electroporation GABA and glycine neuron GABA or glycine neuron GABA or glycine neuron Tg[MiCiVGATK]2 Marker pMiCiVGATK DNA/RNA electroporation GABA and glycine neuron GABA or glycine neuron GABA or glycine neuron Tg[MiCiPC2K]2 Marker pMiCiPC2K DNA/RNA electroporation peptide neuron peptide neuron peptide neuron Transgenic line not listed in the database Other EJ[MiTSAdTPOG]71 Enhancer detection pMiTSAdTPOG jump starter no expression posterior part of the stomach TatACTACCTGtTATTGCAAGACCAAAGCCAAAAATAATCtTTTTAtGCAACATCATTATCG KH.L20.24 EJ[MiTSAdTPOG]75 Enhancer detection pMiTSAdTPOG jump starter no expression stomach TAGAATATAAACATTACCTGTAGTAGCATGAACAACTTGATTTACTGACACA Ci-VWFL3 EJ[MiTSAdTPOG]87 Enhancer detection pMiTSAdTPOG jump starter no expression intestine TAtATGGCATGTTGCAGCTGTTTAAATATACCATTTCACACCTTAGTATATA Ci-ADCY5/6 EJ[MiTSAdTPOG]92 Enhancer detection pMiTSAdTPOG jump starter no expression pyloric gland TATTATGTATGGGTGAGGTACAGTGAGGCACGCCATGGGACCTGGGGTTTA Ci-SoxD EJ[MiTSAdTPOG]101 Enhancer detection pMiTSAdTPOG jump starter no expression stomach TaGTAGTTTGtAGTTAAGTATTTACTCTGTTACTTCACTATGAGGACCAACG Ci-ELOVL3/6a EJ[MiTSAdTPOG]107 Enhancer detection pMiTSAdTPOG jump starter no expression gut TAGAACTTATTCAGTGGTAATTGTATCTCTTGTTGATAGTAGCCCTTTTAAA Ci-FoxA-b EJ[MiTSAdTPOG]123 Enhancer detection pMiTSAdTPOG jump starter no expression pyloric gland TACCCCTTGATAAACAAGAACGGAGGCAACTGGTCGGTTCGGGATATTACC Ci-SMG5, Ci-groucho2 EJ[MiTSAdTPOG]65 Enhancer detection pMiTSAdTPOG jump starter no expression gill EJ[MiTSAdTPOG]103 Enhancer detection pMiTSAdTPOG jump starter no expression gill EJ[MiTSAdTPOG]62 Enhancer detection pMiTSAdTPOG jump starter no expression edge of the oral and atrial siphon cupular organ TACCTGTAAAGTTCATTAAATTTTTGAAGCCACTTTAAAATTATGACAAC KH.C1.950/Ci-HSPA12 EJ[MiTSAdTPOG]104 Enhancer detection pMiTSAdTPOG jump starter no expression endostyle, CNS EJ[MiTSAdTPOG]111 Enhancer detection jump starter no expression endostyle EJ[MiTSAdTPOG]115 Enhancer detection pMiTSAdTPOG jump starter no expression CNS EJ[MiTSAdTPOG]117 Enhancer detection pMiTSAdTPOG jump starter no expression endostyle, peripharyngeal band, retropharyngeal band EJ[MiTSAdTPOG]58-1 Enhancer detection pISMiTSAdTPOG jump starter no expression neural tissue EJ[MiTSAdTPOG]60 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, peripharyngeal band, retropharyngeal band, gill, neural tissue, epidermis EJ[MiTSAdTPOG]68 Enhancer detection pMiTSAdTPOG jump starter no expression endostyle, cerebral ganglion EJ[MiTSAdTPOG]76 Enhancer detection pISMiTSAdTPOG jump starter papillae, CNS, endoderm endostyle, peripharyngeal band, retropharyngeal band, oesophagus EJ[MiTSAdTPOG]78 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, retropharyngeal band Tg[MiCiTnIG]3 Marker pMiCiTnIG jump starter muscle muscle, heart muscle, heart Tg[MiCiTPOGalUASG]1 UAS/Gal4 pMiCiTPOGalUASG UAS/Gal4 no expression a part of endostyle (GFP) no expression Tg[MiCiTPOGalUASG]2 UAS/Gal4 pMiCiTPOGalUASG UAS/Gal4 no expression a part of endostyle (GFP) no expression EJ[MiTSAdTPOG]70 Enhancer detection pMiTSAdTPOG jump starter no expression gill, stigmatal cell, endostyle EJ[MiTSAdTPOG]73 Enhancer detection pMiTSAdTPOG jump starter no expression gill, stigmatal cell, CNS, ganglion EJ[MiTSAdTPOG]88 Enhancer detection pMiTSAdTPOG jump starter no expression tunic cell EJ[MiTSAdTPOG]88-7 Enhancer detection pMiTSAdTPOG jump starter no expression blood cell, endostyle EJ[MiTSAdTPOG]88-8 Enhancer detection pMiTSAdTPOG jump starter no expression CNS, dorsal strand, ganglion EJ[MiTSAdTPOG]106 Enhancer detection pMiTSAdTPOG jump starter no expression CNS, ganglion, body wall muscle EJ[MiTSAdTPOG]125 Enhancer detection pMiTSAdTPOG jump starter no expression dorsal strand TAGGTCGGATTATGTCATTACCCCGTCGGCTACGATAGCGCACGCAGTGACGAAGGTAGATAATAAGAGCGACGTACGTTTTAAAACCACCTACGCGTCG KH.C8.840 E[MiTSAdTPOG]25 Enhancer detection pISMiTSAdTPOG jump starter no expression gill, oral siphon, E[MiTSAdTPOG]26 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, blood cell, E[MiTSAdTPOG]27 Enhancer detection pISMiTSAdTPOG jump starter no expression endostyle, gill, stigmatal cell Tg[MiCiPC2K]3 Marker pMiCiPC2K DNA/RNA electroporation peptide neuron peptide neuron peptide neuron EJ[MiTSAdTPOG]91 Enhancer detection pMiTSAdTPOG jump starter no expression gill, intestine, epidermis, endostyle EJ[MiTSAdTPOG]77 Enhancer detection pISMiTSAdTPOG jump starter no expression blood, endostyle, retropharyngeal band, stomach, esophagus no gill slit(EJ[MiTSAdTPOG]124) Mutant pMiTSAdTPOG jump starter CNS posterior part of the intestine, endostyle, epidermis, and muscle loss of gill, atrial siphon muscle and body wall muscle TAGTATGTTTCGCTTTGAAAGAAATAGTGTTTGCATTTTGG Ci-Hox1 Tg[MiFr3dTPOCCiPrmSB100x]1 Jump starter/Mutator pMiFr3dTPOCCiPrmSB100x DNA/RNA electroporation no expression endostyle, peripharyngeal band, retropharyngeal band (CFP) endostyle, peripharyngeal band, retropharyngeal band (CFP), testis, sperm (SB100x) Tg[MiFr3dTPOCCiPrmSB100x]2 Jump starter/Mutator pMiFr3dTPOCCiPrmSB100x DNA/RNA electroporation no expression endostyle, peripharyngeal band, retropharyngeal band (CFP) endostyle, peripharyngeal band, retropharyngeal band (CFP), testis, sperm (SB100x) Tg[MiFr3dTPOCCiNutSB100x]1 Jump starter/Mutator pMiFr3dTPOCCiNutSB100x DNA/RNA electroporation no expression endostyle, peripharyngeal band, retropharyngeal band (CFP) endostyle, peripharyngeal band, retropharyngeal band (CFP), ovary, oocytes, eggs (SB100x) Tg[MiFr3dTPOCCiNutSB100x]2 Jump starter/Mutator pMiFr3dTPOCCiNutSB100x DNA/RNA electroporation no expression endostyle, peripharyngeal band, retropharyngeal band (CFP) endostyle, peripharyngeal band, retropharyngeal band (CFP), ovary, oocytes, eggs (SB100x) Tg[T2dTPOG]1 Jump starter/Mutator pT2dTPOG DNA/RNA electroporation no expression a part of endostyle Tg[T2dTPOG]3 Jump starter/Mutator pT2dTPOG DNA/RNA electroporation no expression a part of endostyle Tg[MiCiZipCiFkhK]1 Marker pMiCiZipCiFkhK DNA/RNA electroporation endodermal strand intestine intestine Tg[MiCiVGLUTK]5 Marker pMiCiVGLUTK DNA/RNA electroporation glutamate neuron glutamate neuron glutamate neuron, muscle Tg[MiCiVGLUTK]6 Marker pMiCiVGLUTK DNA/RNA electroporation glutamate neuron glutamate neuron glutamate neuron, muscle Tg[MiCiTnIGCipemG]2 MASK pMiCiTnIGCipemG DNA/RNA electroporation muscle muscle muscle gastrulation defect taTTACCTAGTGGTATTTTTGCAACGATTCGTAAGCAATGAGATATATATATTATAAACT Tg[MiCiTnIGCipemG]9 MASK pMiCiTnIGCipemG DNA/RNA electroporation muscle muscle muscle, oocyte, egg Tg[MiCiTnIGCimTG]1 MASK pMiCiTnIGCimTG DNA/RNA electroporation muscle muscle muscle tail morphology defect Ciinte.Tg[pMi-Ciinte.EF1a>mKO2::hCdt1(1/100)]1 Indicator pMi-Ciinte.EF1a>mKO2::hCdt1(1/100) DNA/RNA electroporation ubiquitous ubiquitous ubiquitous Ciinte.Tg[pMi-Ciinte.EF1a>mVeuns::hGem(1/110);Ciinte.EF1a>H2B::CFP]1 Indicator pMi-Ciinte.EF1a>mVenus::hGem(1/110);Ciinte.EF1a>H2B::CFP DNA/RNA electroporation ubiquitous ubiquitous ubiquitous Tg[MiCib2TBC]3 Marker pMi-Ciinte.REG.KH2012.L116.156051-160357>CFP DNA/RNA electroporation pan neuron pan neuron,muscle, endostyle, peripharyngeal band, stigmata, intestine pan neuron,muscle, endostyle, peripharyngeal band, stigmata, intestine Tg[MiCiVACHTC]2 Marker DNA/RNA electroporation cholinergic neuron cholinergic neuron cholinergic neuron Fixed specimen not listed in the database Fixed Specimen Tg[MiCib2TBC]4 Marker pMi-Ciinte.REG.KH2012.L116.156051-160357>CFP DNA/RNA electroporation pan neuron,muscle, endostyle, peripharyngeal band, stigmata, intestine pan neuron,muscle, endostyle, peripharyngeal band, stigmata, intestine Tg[MiCiNutK]4 Marker pMi-Ciinte.REG.KH2012.C14.1414848-1413819|Nut>Kaede DNA/RNA electroporation neural tissue neural tissue neural tissue Tg[MiCiNutK]8 Marker pMi-Ciinte.REG.KH2012.C14.1414848-1413819|Nut>Kaede DNA/RNA electroporation neural tissue neural tissue neural tissue Tg[MiCiCRALBPK]1 Marker pMi-Ciinte.REG.KH2012.C11.2432890-2434422>Kaede DNA/RNA electroporation neural tissue neural tissue Tg[MiCiVGLUT4.3K]2 Marker pMi-Ciinte.REG.KH2012.C3.4783622-4779194>Kaede DNA/RNA electroporation glutamate neuron glutamate neuron Tg[MiCiPC2mChe]1 Marker pMi-Ciinte.REG.KH2012.L128.232780-230970|PC2>mCherry DNA/RNA electroporation neurons Neurons Tg[MiCiHox12K]1 Marker pMi-Ciinte.REG.KH2012.C7.2704879-2706900>Kaede DNA/RNA electroporation nerve cord, endoderm Intestine Hox12TAL2 Mutant Genome editing Tg[T2CiFr3dTPORCipemG]3 MASK pT2CiFr3dTPORCipemG DNA/RNA electroporation endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) gastrulation defect Tg[Fr3dTPORCipemG]4 MASK pFr3dTPORCipemG DNA electroporation endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) gastrulation defect Tg[MiFr3dTPORCipemK]5 MASK pMiFr3dTPORCipemK DNA/RNA electroporation endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) gastrulation defect Tg[MiFr3dTPORCipemwtG]3 MASK pMiFr3dTPORCipemwtG DNA/RNA electroporation endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) gastrulation defect Tg[MiFr3dTPORCipemwtG]4 MASK pMiFr3dTPORCipemwtG DNA/RNA electroporation endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) gastrulation defect Tg[MiFr3dTPORCipemwtG]6 MASK pMiFr3dTPORCipemwtG DNA/RNA electroporation endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) gastrulation defect Tg[MiCiTnIGCipemG]1 MASK pMiCiTnIGCipemG DNA/RNA electroporation muscle muscle muscle, oocyte, egg gastrulation defect Tg[MiCiHox13K]1 Marker pMiCiHox13>Kaede;CiHox13Int Germ cell regeneration digestive tube, epidermis digestive tube, epidermis, orange pigmented organ, neurons, sperm duct epithelium Tg[MiCiHox13K]2 Marker pMiCiHox13>Kaede;CiHox13Int Germ cell regeneration digestive tube, epidermis digestive tube, epidermis, orange pigmented organ, neurons, sperm duct epithelium Tg[MiCiPC2GCaMP8Fr3dTPOR]1 Indicator pMiCiPC2>GCaMP8 DNA/RNA electroporation neurons (GCaMP8) neurons (GCaMP8), endostyle, peripharyngeal band, retropharyngeal band (DsRed) neurons (GCaMP8), endostyle, peripharyngeal band, retropharyngeal band (DsRed) Tg[MiCiPC2GCaMP8Fr3dTPOR]2 Indicator pMiCiPC2>GCaMP8 DNA/RNA electroporation neurons (GCaMP8) neurons (GCaMP8), endostyle, peripharyngeal band, retropharyngeal band (DsRed) neurons (GCaMP8), endostyle, peripharyngeal band, retropharyngeal band (DsRed) Tg[MiCiETRGCaMP8Fr3dTPOR]1 Indicator pMiCiETR>GCaMP8 DNA/RNA electroporation CNS (GCaMP8) edge of oral siphon (GCaMP8), endostyle, peripharyngeal band, retropharyngeal band (DsRed) endostyle, peripharyngeal band, retropharyngeal band (DsRed) Tg[MiCignrh2K]1 Marker pMiCignrh2>K DNA/RNA electroporation CNS CNS, PNS at the edge of siphons Tg[MiCignrh2K]2 Marker pMiCignrh2>K DNA/RNA electroporation CNS CNS, PNS at the edge of siphons Tg[MiCiVPV]1 Marker pMiCiVPV DNA/RNA electroporation CNS, PNS at the edge of siphons, Digestive tube CNS