Name Type Vector Created Method Expression at the larval stage Expression at the juvenile stage Expression at the adult stage Phenotypes Sequence of insertion site Gene present at the insertion site swimming juvenile (Tg[MiTFr3dTPOG]45) Mutant pMiTFr3dTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle, peripharyngeal band, retropharyngeal band defect in metamorphosis and tunic formation Ci-CesA swimming juvenile2 (Tg[MiTFr3dTPOG]153) Mutant pMiTFr3dTPOG DNA/RNA microinjection no expression endostyle, peripharyngeal band, retropharyngeal band endostyle, peripharyngeal band, retropharyngeal band tail regression failed Mutant natural defect in metamorphosis no gill slit(EJ[MiTSAdTPOG]124) Mutant pMiTSAdTPOG jump starter CNS posterior part of the intestine, endostyle, epidermis, and muscle loss of gill, atrial siphon muscle and body wall muscle TAGTATGTTTCGCTTTGAAAGAAATAGTGTTTGCATTTTGG Ci-Hox1 Hox12TAL2 Mutant Genome editing VPTAL2 Mutant Genome editing VPTAL3 Mutant Genome editing