Hox12 (KH.C7.472)
Vector name |
pBSCiEpiI>mcherry-CiEF1a>TALENCiHox12L pBSCiEpiI>mcherry-CiEF1a>TALENCiHox12R pBSCiEpiI>mcherry-CiEpiI>TALENCiHox12L pBSCiEpiI>mcherry-CiEpiI>TALENCiHox12R pHTBHox12 TALEN L pHTBHox12 TALEN R pBSCiEpiImCherryCiTiTF1CiHox12 TALEN L pBSCiEpiImCherryCiTiTF1CiHox12 TALEN R |
Target sequence (lower case: spacer) | ACACTAAGTACCAACTTtccgagctagaaAGAGAGTTCGGAGCGA (upper case indicates the TALEN binding sites, and lower case indicates spacer) |
Position of target site | homeodomain |
Primers for mutation detection (5’to 3’) | TTGTAGCTCACGACCATGTAG ATCTTCGTCCTCTACAGACTG |
CelI analysis | Hox12-EF-CelI.pdf |
Sequenced mutations | Hox12-EF1-mutation.pdf |
Reference |
Treen et al (2014) Development 141, 481-487
Yoshida et al (2017) Development 144, 1629-1634 |