Hox13 (KH.C7.99)
Vector name |
pEF1>Hox13 TALEN L1 pEF1>Hox13 TALEN R1 pTitf1>Hox13 TALEN L1 pTitf1>Hox13 TALEN R1 pAKR>Hox13 TALEN L1 pAKR>Hox13 TALEN R1 pCesA>Hox13 TALEN L1 pCesA>Hox13 TALEN R1 pNut>Hox13 TALEN L1 pNut>Hox13 TALEN R1 pTnI>Hox13 TALEN L1 pTnI>Hox13 TALEN R1 pMesp>Hox13 TALEN L1 pMesp>Hox13 TALEN R1 pHTBHox13 TALEN L1 pHTBHox13 TALEN R1 |
Target sequence (lower case: spacer) | ACAAAGCAAACAACTTcataacgcgacagaaaAGAGAAAACATTGCAAG (upper case indicates the TALEN binding sites, and lower case indicates spacer) |
Position of target site | homeodomain |
Primers for mutation detection (5’to 3’) | GTTCTTTCGACAGTTACTTGTG CTGGTGGTGCTACAGAGCAAAG |
CelI analysis | HMA-Hox13.pdf |
Sequenced mutations | Hox13-genome-mutations.pdf |
Reference | Tajima et al (2020) Developmental Biology 458:120-131 |