gnrh1 ver2 (KY21.Chr1.1655)
| Vector name |
 pEF1>gnrh1 TALEN L2pEF1>gnrh1 TALEN R2pHTB>gnrh1 TALEN L2pHTB>gnrh1 TALEN R2 |
| Target sequence (lower case: spacer) | AGCGGGAAATTCGACTctctaaagctgcagaatAATTTCCCTCATCTCG (upper case indicates the TALEN binding sites, and lower case indicates spacer) |
| Position of target site | ORF |
| Primers for mutation detection (5’to 3’) | acttcacaaatgttggatatcg gttggcttgcttgtatctgttc |
| CelI analysis |
 HMA-gnrh1-2.pdf
|
| Sequenced mutations |
gnrh1-2-genome-mutations.pdf
|
| Reference | Hozumi A et al (2020) Curr Biol 30(8),1555-1561.e4 |