gnrh2 (KY21.Chr9.123)

Vector name pEF1>gnrh2 TALEN L1
pEF1>gnrh2 TALEN R1
pHTB>gnrh2 TALEN L1
pHTB>gnrh2 TALEN R1
Target sequence (lower case: spacer) CTTCCTTCTAACAACGAggagcggcgtcagcattGGTCTTATGCTTTATC
(upper case indicates the TALEN binding sites, and lower case indicates spacer)
Position of target site peptide conding region
Primers for mutation detection (5’to 3’) cgtaacaatgacgtcattagtg
cgaccagtgttgtcttttacc
CelI analysis HMA-gnrh2.pdf
Sequenced mutations gnrh2-genome-mutations.pdf
Reference Hozumi A et al (2020) Curr Biol 30(8),1555-1561.e4