gnrh2 (KY21.Chr9.123)
Vector name |
pEF1>gnrh2 TALEN L1 pEF1>gnrh2 TALEN R1 pHTB>gnrh2 TALEN L1 pHTB>gnrh2 TALEN R1 |
Target sequence (lower case: spacer) | CTTCCTTCTAACAACGAggagcggcgtcagcattGGTCTTATGCTTTATC (upper case indicates the TALEN binding sites, and lower case indicates spacer) |
Position of target site | peptide conding region |
Primers for mutation detection (5’to 3’) | cgtaacaatgacgtcattagtg cgaccagtgttgtcttttacc |
CelI analysis | HMA-gnrh2.pdf |
Sequenced mutations | gnrh2-genome-mutations.pdf |
Reference | Hozumi A et al (2020) Curr Biol 30(8),1555-1561.e4 |