Strain Detail

If you wish to request for strains, please contact Yasunori Sasakura () to check if stock is available.

* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.

Name E[MiCiTPOG]2
Type Enhancer detection
Vector pMiCiTPOG
transgene (derived organism)  • Minos (Drosophila hydei)
 • pBluescript (plasmid vector)
 • GFP (Aequorea victoria)
 • SV40 polyadenylation sequence (Papovavirus SV40)
 • nuclear localization sequence (Papovavirus SV40)
Created Method DNA/RNA microinjection
Expression at the larval stage no expression
Expression at the juvenile stage endostyle, peripharyngeal band, retropharyngeal band
Expression at the adult stage endostyle (zone 2, 4, 8), peripharyngeal band, retropharyngeal band, languet
Picture at the larval stage
Picture at the juvenile stage
Picture at the adult stage
Phenotypes
Sequence of insertion site TAGAGGTACAAAGATTCTGGTGTTTAAAAAGGTTAAGAACCACTGCTGTATTTTACA
Gene present at the insertion site Ci-musashi
Reference Awazu S et al., An enhancer trap in the ascidian Ciona intestinalis identifies enhancers of its Musashi orthologous gene., Dev Biol. 2004 Nov 15;275(2):459-72.

Available sperm
juvenile
adult
 animal(s)