Strain Detail
If you wish to request for strains, please contact Yasunori Sasakura () to check if stock is available.
* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.
Name | E[MiCiTPOG]2 | |
Type | Enhancer detection | |
Vector | pMiCiTPOG | |
transgene (derived organism) |
• Minos (Drosophila hydei)
• pBluescript (plasmid vector) • GFP (Aequorea victoria) • SV40 polyadenylation sequence (Papovavirus SV40) • nuclear localization sequence (Papovavirus SV40) |
|
Created Method | DNA/RNA microinjection | |
Expression at the larval stage | no expression | |
Expression at the juvenile stage | endostyle, peripharyngeal band, retropharyngeal band | |
Expression at the adult stage | endostyle (zone 2, 4, 8), peripharyngeal band, retropharyngeal band, languet | |
Picture at the larval stage | ||
Picture at the juvenile stage |
![]() |
|
Picture at the adult stage | ||
Phenotypes | ||
Sequence of insertion site | TAGAGGTACAAAGATTCTGGTGTTTAAAAAGGTTAAGAACCACTGCTGTATTTTACA | |
Gene present at the insertion site | Ci-musashi | |
Reference |
Awazu S et al., An enhancer trap in the ascidian Ciona intestinalis identifies enhancers of its Musashi orthologous gene., Dev Biol. 2004 Nov 15;275(2):459-72.
|
|
Available | sperm | |
juvenile | ||
adult |