Strain Detail

If you wish to request for strains, please contact Yasunori Sasakura ( ) to check if stock is available.

* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.

Name EJ[MiTSAdTPOG]107
Type Enhancer detection
Vector pMiTSAdTPOG
transgene (derived organism)  • Splicing acceptor sequence (Oryctolagus cuniculus)
 • pBluescript (plasmid vector)
 • GFP (Aequorea victoria)
 • nuclear localization sequence (Papovavirus SV40)
 • Minos (Drosophila hydei)
 • SV40 polyadenylation sequence (Papovavirus SV40)
Created Method jump starter
Expression at the larval stage no expression
Expression at the juvenile stage gut
Expression at the adult stage
Picture at the larval stage
Picture at the juvenile stage
Picture at the adult stage
Phenotypes
Sequence of insertion site TAGAACTTATTCAGTGGTAATTGTATCTCTTGTTGATAGTAGCCCTTTTAAA
Gene present at the insertion site Ci-FoxA-b
Reference Yoshida R et al (2012) Zool. Sci. 29(1),11-20

Kawai et al (2015) Developmental Biology 403, 43-56

Available sperm
juvenile
adult
 animal(s)