Strain Detail

If you wish to request for strains, please contact Yasunori Sasakura ( ) to check if stock is available.

* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.

Name Tg[MiCiAKRK]1
Type Marker
Vector pMiCiAKRK
transgene (derived organism)  • Minos (Drosophila hydei)
 • pBluescript (plasmid vector)
 • Kaede (Trachyphyllia geoffroyi)
 • SV40 polyadenylation sequence (Papovavirus SV40)
 • Gateway recombination sequence (lambda phage)
Created Method DNA electroporation into Ju[SBFr3dTPORCiNutMiTP]1 egg
Expression at the larval stage mesenchyme
Expression at the juvenile stage blood cells, tunic cells, stomach, intestine
Expression at the adult stage
Picture at the larval stage
Picture at the juvenile stage
Picture at the adult stage
Phenotypes
Sequence of insertion site TATTGTCTGTTTGATCAGCTGCGTTCAATCAGTCGCCTGAAATTCGACCA,
TACATTTAAGCCTTGCCTGTAAACGCTAAATTTAGTTAAGCCCACGTTTA
Gene present at the insertion site KH.C9.476
Reference Hozumi A et al (2010) Dev. Dyn. 239(4),1076-88

Sasakura Y et al (2018) Wiley Interdiscip Rev Dev Biol 7(2),

Available sperm
juvenile
adult
 animal(s)