Strain Detail
If you wish to request for strains, please contact Yasunori Sasakura () to check if stock is available.
* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.
Name | no gill slit(EJ[MiTSAdTPOG]124) | |
Type | Mutant | |
Vector | pMiTSAdTPOG | |
transgene (derived organism) |
• Minos (Drosophila hydei)
• pBluescript (plasmid vector) • GFP (Aequorea victoria) • SV40 polyadenylation sequence (Papovavirus SV40) • nuclear localization sequence (Papovavirus SV40) • Splicing acceptor sequence (Oryctolagus cuniculus) |
|
Created Method | jump starter | |
Expression at the larval stage | CNS | |
Expression at the juvenile stage | posterior part of the intestine, endostyle, epidermis, and muscle | |
Expression at the adult stage | ||
Picture at the larval stage | ||
Picture at the juvenile stage |
![]() ![]() |
|
Picture at the adult stage | ||
Movie | ||
Phenotypes | loss of gill, atrial siphon muscle and body wall muscle | |
Sequence of insertion site | TAGTATGTTTCGCTTTGAAAGAAATAGTGTTTGCATTTTGG | |
Gene present at the insertion site | Ci-Hox1 | |
Reference |
Ikuta T et al (2010) Development 137(9),1505-13
Sasakura Y et al (2012) Development 139(12),2156-60 Yoshida et al (2017) Development 144, 1629-1634 Sasakura Y et al (2018) Wiley Interdiscip Rev Dev Biol 7(2), |
|
Available | sperm | |
juvenile | ||
adult |