Strain Detail

If you wish to request for strains, please contact Yasunori Sasakura () to check if stock is available.

* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.

Name no gill slit(EJ[MiTSAdTPOG]124)
Type Mutant
Vector pMiTSAdTPOG
transgene (derived organism)  • Minos (Drosophila hydei)
 • pBluescript (plasmid vector)
 • GFP (Aequorea victoria)
 • SV40 polyadenylation sequence (Papovavirus SV40)
 • nuclear localization sequence (Papovavirus SV40)
 • Splicing acceptor sequence (Oryctolagus cuniculus)
Created Method jump starter
Expression at the larval stage CNS
Expression at the juvenile stage posterior part of the intestine, endostyle, epidermis, and muscle
Expression at the adult stage
Picture at the larval stage
Picture at the juvenile stage
Picture at the adult stage
Movie
Phenotypes loss of gill, atrial siphon muscle and body wall muscle
Sequence of insertion site TAGTATGTTTCGCTTTGAAAGAAATAGTGTTTGCATTTTGG
Gene present at the insertion site Ci-Hox1
Reference Ikuta T et al (2010) Development 137(9),1505-13

Sasakura Y et al (2012) Development 139(12),2156-60

Yoshida et al (2017) Development 144, 1629-1634

Sasakura Y et al (2018) Wiley Interdiscip Rev Dev Biol 7(2),

Available sperm
juvenile
 dish(es)
adult
 animal(s)